Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name HSP26
Systematic Name YBR072W
Description Small heat shock protein (sHSP) with chaperone activity; forms hollow, sphere-shaped oligomers that suppress unfolded proteins aggregation; oligomer activation requires heat-induced conformational change; also has mRNA binding activity
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HSP26	6319546 upstream sequence, from -1000 to -1, size 1000
CGTTGGACTTTTTTTAATATAACCTACCATAGGACACACTTTGTTGTTGATGTTGGACAA
TTCGTTAATTAAGAGTCCCTAAACGGCTCTACTAGTTCCAACCTCACTTTGTTTTTTCAT
TTTTTTATGTTTTTTCTAGAACCTTCTTTACGTGATTCTCGCTCGGAATCCGTCAATAGA
ATGTTTTCAGTCTCCGTTTCAATATTCTGCGCACATCAATCATTTTCTTACTACATACAC
TAACATTACTCCTAGTTTAATTTAATTGAATTTTTAACTTTCTTTTCTTTTCATTTGGCA
ATTTGGCTCCTTGAAAACAAGACTATGGGTCTCTCTCATAAGCCTCAGGGGGGGACCCCA
AAAAAATAACGCGGCCATCTTGCATGCACCGTTGAACCTGTAGCTTACAGTAAGCCACAA
TTCTCTTACCTTCTTGGCAATGTGGCACAAAATAATCTGGTTATGTGTCTTCATTTGGTA
ATCACTGGGATGTTACTGGGGCAGCAGCAACTCCGTGTGTACCCCTAACTCCGTGTGTAC
CCCTAAAGAACCTTGCCTGTCAAGGTGCATTGTTGGATCGGAATAGTAACCGTCTTTACA
TGAACATCCACAACCAACGAAAGTGCTTTTTCAAGCATTGCTTGATTTCTAGAAAGATCG
ATGGTTATTCCCTCCCCCTTATGCGTCCAAAAATATAGGGTGCTCGTAACAGTAAGGTAT
TCGCACTTAGCGTGCTCGCAACACAAAATTAAGTAATATGCGAGTTTTAGATGTCCTTGC
GGATCTATGCACGTTCTTGAGTGGTATTTCATAACAACGGTTCTTTTTCACCCTTATTCC
TAAACATATAAATAGGACCTCCATTAGTTAGAGATCTGTTTTTAATCCATTCACCTTTCA
TTCTACTCTCTTATACTAATAAAACCACCGATAAAGATATATCAGATCTCTATTAAAACA
GGTATCCAAAAAAGCAAACAAACAAACTAAACAAATTAAC
Chromosomal Coordinates Chr II from 382030-382674
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator