Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ALG14
Systematic Name YBR070C
Description Component of UDP-GlcNAc transferase required for the second step of dolichyl-linked oligosaccharide synthesis; anchors the catalytic subunit Alg13p to the ER membrane; similar to bacterial and human glycosyltransferases
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YBR070C	6319544 upstream sequence, from -1000 to -1, size 1000
AAGACAAAGAGAGCTTTAGAATCATCGATTGCTATTGTGTTGTTAATTTTGAAAGCGTCT
GTTTTATCCATCTCTTCAATATCTTCGTACAACAAATCGTGAATGGAATAGTCATTATCT
TGGGAAAATATGGAAGAGATCGAGCTCTTGGTGGAGGAAAGACTGGCGTCTGATTCGCTC
CTCGTTGACTGCGTTGGTGATGGAGCCATCCGCAGCTTTTCTTCCTTTGCAGCGTTTGTT
TGCATGTGCCTCATGGCCGAGTGGTAGTCTTTAAGCAGTGTTTCGTCCAGTAACAAGCTG
CTCCTTTTTAACTTTGACTGACTAGATGTGCTTCTCTTATTCGTAGGAGACAGGAATTGA
GAAGGAGCTGTGCCCTCCTCCTTTTTCTGCTTCGTCTTGGAGTGTCCATGGCCAAATTCG
CTAGTCAGCGAGATTAGCGAACTTTTGGATCCTAAATGCATGGATTGTCTTTTCTTGGTG
TCTGCGTTTGTGTTAGTGCTGGAATTTTTAGAGCGTCTTAGCATTTTACGTATTTTGTCT
TTTTGTGCCGTCACAATATATAGTTGGTATGTTCTTTATCGTCGTATATTTCTCGTGCCG
AGCTTGCGCCTTCTTTAACAATAAACCAAACGAATATTGAGGCTTCTTTATAACAGTTTG
GCAAATAGTCAAGAATATAATGAGCAGCCAAGCGCGAAATTATGAATTCTATTAATATCC
GCACTAGTGAATTCGAATACTTCCTTTACAGGTCATTTTCTCCTATTGCTCCAATTTACA
CTGCTGTGCTTTTTTTTTTAATTACGCGCATTAGGTAATTTTACCCCTACGCGAAAGTTA
GTCGTAATTTCGTGTTTCTTTTTTTACGTGTTCTGTCTGTCCAGAAGCAAAAATGTTCTT
AGCGAAGCCATCCTAATATTTCATGTACAAGGGCCCGCAATAACTGTAATCGGCGGTTTA
TTATTGTATCAGGAAAGTCGAAAGAAGTGACTTGAAGATC
Chromosomal Coordinates Chr II from 379934-379221
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator