Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ETR1
Systematic Name YBR026C
Alias MRF1, MRF1'
Description 2-enoyl thioester reductase, member of the medium chain dehydrogenase/reductase family; localized to in mitochondria, where it has a probable role in fatty acid synthesis
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ETR1	6319500 upstream sequence, from -1000 to -1, size 1000
CTGTGCGCCTGAAATATTATTAGGTAAAGCTTACAGTCAGAATTGTGATTGGTATTCTTT
GGGATGTCTGTTGTATGACATGTTAGTAGGTAAGCCTCCATATACTGGTAGCAATCATAA
GGTGATCATTAATAAGATTCAACAAAACAAGCAAGGCCCCAAAATTCCATTTTATCTGAG
CGAGGGAATGAAAGATATATTAAACGCGCTGTTGAAGAAGGAAACTGCCAAAAGGTGGAA
TGTTGACAAATACTGGGCCAAAACCGGGGCTAATAATAAGCCTACTAAGTCTAAGAAGAA
GAAATCAGGGGCTGCAAGAACTAGTCTTTTCACTGAACATTTTATCTTTAGAAAAATAGA
CTGGAAGTTATTAGAATCTGGACAATTGCAAAAAACCACTCTAGGCCCAATTGTTCCAGT
TATTACGGATTTGGAACTAGCGGAAAATTTTGACACAGAATTTACTTCTATGTCATATGA
GGAAACCTATACGGATAGCAAGCCGATTAATATCAATTCGGTGAGCAAGTCCCCGGATAT
GTTCAAGGGATTTAGTTATAAAGCAAGTGGTAGCTATTTGGAGAAGTACTTTTGAATTAA
AAGTTAGATAGATTAAGAGAGAAGGCTCGGATCTGCACTGACTTACTTTTTTTTGTTTTT
TTGATGTTTAAAGGATCTGTGTCACTGTATATACTTTGTTTTGCTTTAGGGTTACGAAAC
ACATTTTTAATATATAATGTATGTAATAATATTAAAAACAACTGTATGGATAATACTTCT
GGACCAATCGGTGATACCATCTTCCTTATTTATGGTATTATTATCATTATTGGACCCCGC
CGGTGCTTTTTTTTTTACCTTAAAAGAGTGGTTCTCCTCCAAGGGACGCACGAGTGGTGT
ACCCAGGGGTTGTTTCCATGGCTAAAGAAATTGGAGATTACAAACGTACATTGTCATTTA
AGAAGGTTCATAATCTGCCAATTACATTTGATATAACAAG
Chromosomal Coordinates Chr II from 294019-292877
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator