Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name GAL10
Systematic Name YBR019C
Description UDP-glucose-4-epimerase, catalyzes the interconversion of UDP-galactose and UDP-D-glucose in galactose metabolism; also catalyzes the conversion of alpha-D-glucose or alpha-D-galactose to their beta-anomers
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GAL10	6319493 upstream sequence, from -1000 to -1, size 1000
CCGTCCAACGGCAAATCGAACTTCCTTTGAGCAAATTTGGGATCAGCATTTATTAAGGTA
ATGGATGGATTTTTCTCGTTCAAAACTTTGACGGCGCAAAGCATATCAAAATCAATAGCT
AAAGGTAAAACCGAGAAGTCACAATAATCAATATGTTCACCAATTAGATTGACTCTACCA
GGCGATCTAGCAACAAAATCCGGTTTAGCATCATAAGCGCTTATAAATTTCTTAATTATG
CTCGGGCACTTTTCGGCCAATGGTCTTGGTAATTCCTTTGCGCTAGAATTGAACTCAGGT
ACAATCACTTCTTCTGAATGAGATTTAGTCATTATAGTTTTTTCTCCTTGACGTTAAAGT
ATAGAGGTATATTAACAATTTTTTGTTGATACTTTTATGACATTTGAATAAGAAGTAATA
CAAACTGAAAATGTTGAAAGTATTAGTTAAAGTGGTTATGCAGCTTTTCCATTTATATAT
CTGTTAATAGATCAAAAATCATCGCTTCGCTGATTAATTACCCCAGAAATAAGGCTAAAA
AACTAATCGCATTATCATCCTATGGTTGTTAATTTGATTCGTTAATTTGAAGGTTTGTGG
GGCCAGGTTACTGCCAATTTTTCCTCTTCATAACCATAAAAGCTAGTATTGTAGAATCTT
TATTGTTCGGAGCAGTGCGGCGCGAGGCACATCTGCGTTTCAGGAACGCGACCGGTGAAG
ACGAGGACGCACGGAGGAGAGTCTTCCGTCGGAGGGCTGTCGCCCGCTCGGCGGCTTCTA
ATCCGTACTTCAATATAGCAATGAGCAGTTAAGCGTATTACTGAAAGTTCCAAAGAGAAG
GTTTTTTTAGGCTAAGATAATGGGGCTCTTTACATTTCCACAACATATAAGTAAGATTAG
ATATGGATATGTATATGGTGGTAATGCCATGTAATATGATTATTAAACTTCTTTGCGTCC
ATCCAAAAAAAAAGTAAGAATTTTTGAAAATTCAATATAA
Chromosomal Coordinates Chr II from 278352-276253
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator