Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name FUI1
Systematic Name YBL042C
Description High affinity uridine permease, localizes to the plasma membrane; also mediates low but significant transport of the cytotoxic nucleoside analog 5-fluorouridine; not involved in uracil transport
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FUI1	6319429 upstream sequence, from -1000 to -1, size 1000
GCAATAGTGGCCATATTTTGTTTAACTTTATAGTTCAATAGTCTTGGCTACTCTCTTTCC
AACTCAGTTCACCTTGTATTATACCGCTTGTTTTTGCCACCCTTTGAGTTTCCTCGATCC
TTTAAGTTGGAAAAGATAAAAACAATTATCGCTCCGTACGAACACCAAATCTCTGCGACG
CAGAGACGGCAATACAAAATCAGAAAAAAAAAACAATTTATTGCCTATGCTTCACTAGTC
ACAGGCTCTACGAAACATTGCTATCGCCTCACTGCCTTTACATCACTTAAGCAAGAAGTT
TTAAATATTACGGCAATTCCTTTGCAGCAATACCTTTACTTTATTTCGAGAGAAAATAGA
TCGTAAAATGCCTACTCCAAGCTTTTAAATCAAGACTCAACCAAGCCCCCACACTTATCT
TTAGAGACTAATGCCCTAACTCTTTCGACTGAACGGCTTAGAAGTCTCATGTCCTAGCTA
GTTTGTCCTTGCGATGGGACACAAACGGCGCTGCCTCTCCTGCGGGCGATCAGAAAGAAG
AAAAAGAAATGTGATTGAGCCATGCCACAAAGCGGTATGTGCCATTAATTTCTTTTTTTC
TCCCCTTTCGCCTTTGAGTTTCTCCGCGGCGTTCACTGTGGTTGATGCTCGGGATTTGCC
GGTTTCGTCCTTATCGCGCCATCTTTGCCATTAAAGGATGCTGCAATAAAACTTGGCGGT
TCTCGCTACTGAAACTATTGTGTCAGCCTGGACAACACAGGGACATGTCGTATTTTTGAA
AATTTTTGATCAATTCTCCAACGGAAAAGTTTTTCATTTCCTCTCTTGCTCAATTACTCG
ATGACATGCTATCCTATCTTTTATATAACAGTAGTATTGCTTCGACCTTCTTGTAAAATT
TAAAACATAGTATTGGACAGCTTTGCTTTACTTTGCAGCACATTGCGGAAATAAAAGGCG
GTAACTAGTCCTCTCATTCATTAATTCTATATAAGAGAAA
Chromosomal Coordinates Chr II from 140260-138341
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator