Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name PRE7
Systematic Name YBL041W
Alias PRS3
Description Beta 6 subunit of the 20S proteasome
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PRE7	6319430 upstream sequence, from -1000 to -1, size 1000
TCAGATACCGGCATTTTCTCTTATATAGAATTAATGAATGAGAGGACTAGTTACCGCCTT
TTATTTCCGCAATGTGCTGCAAAGTAAAGCAAAGCTGTCCAATACTATGTTTTAAATTTT
ACAAGAAGGTCGAAGCAATACTACTGTTATATAAAAGATAGGATAGCATGTCATCGAGTA
ATTGAGCAAGAGAGGAAATGAAAAACTTTTCCGTTGGAGAATTGATCAAAAATTTTCAAA
AATACGACATGTCCCTGTGTTGTCCAGGCTGACACAATAGTTTCAGTAGCGAGAACCGCC
AAGTTTTATTGCAGCATCCTTTAATGGCAAAGATGGCGCGATAAGGACGAAACCGGCAAA
TCCCGAGCATCAACCACAGTGAACGCCGCGGAGAAACTCAAAGGCGAAAGGGGAGAAAAA
AAGAAATTAATGGCACATACCGCTTTGTGGCATGGCTCAATCACATTTCTTTTTCTTCTT
TCTGATCGCCCGCAGGAGAGGCAGCGCCGTTTGTGTCCCATCGCAAGGACAAACTAGCTA
GGACATGAGACTTCTAAGCCGTTCAGTCGAAAGAGTTAGGGCATTAGTCTCTAAAGATAA
GTGTGGGGGCTTGGTTGAGTCTTGATTTAAAAGCTTGGAGTAGGCATTTTACGATCTATT
TTCTCTCGAAATAAAGTAAAGGTATTGCTGCAAAGGAATTGCCGTAATATTTAAAACTTC
TTGCTTAAGTGATGTAAAGGCAGTGAGGCGATAGCAATGTTTCGTAGAGCCTGTGACTAG
TGAAGCATAGGCAATAAATTGTTTTTTTTTTCTGATTTTGTATTGCCGTCTCTGCGTCGC
AGAGATTTGGTGTTCGTACGGAGCGATAATTGTTTTTATCTTTTCCAACTTAAAGGATCG
AGGAAACTCAAAGGGTGGCAAAAACAAGCGGTATAATACAAGGTGAACTGAGTTGGAAAG
AGAGTAGCCAAGACTATTGAACTATAAAGTTAAACAAAAT
Chromosomal Coordinates Chr II from 141247-141972
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator