Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name FMT1
Systematic Name YBL013W
Description Methionyl-tRNA formyltransferase, catalyzes the formylation of initiator Met-tRNA in mitochondria; potential Cdc28p substrate
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FMT1	6319458 upstream sequence, from -1000 to -1, size 1000
GTTATGTCGGTTTAAATGCAATGTATTTTGTCGTGTCAGAACTGCTATATTTAGGACTGA
GCCTGTTTTACCCGAGGCATATGCTATGATTTCGGTTCCGTCTCTATAATTTCTTAAATC
TGATGCTGTCTGAATATATTGAGAGTCCAGTCGATTAGCCACAGTAGGATCCCAAAAGAA
GGCGTCTTGCATCGGCCTCGAAGAGTTAGTACTTTCTTGTAATGTATCATCTAAGTTGCG
CAGCAAATCTGAAGGAATGTAATCTTGAAATGAAACTGGCGTATCGCAGTTCACACCAAA
CATAGAATCATTACCAACGTCAACTTTCTTAAAAAAATGGACATCTTTCGGTACCACGGG
TATCACTGGATTGACCACTATAGATGTATCCCCCTGATTGTCCGTATCTTCATCAATATC
GCTAGTTATGAGATCATCGTCGGCATCTGATTCTTGCAAAACCTTGTCGTCGGAAATATA
TCTTATGGCAGTATCACAAAGCAGACTTTTGACCACTATATGAAGGTCTAGTGCATCCTC
GGCCAATGTATCATCTACTGGTCTTAGCCATTGTGGGTTTTCTTGCTTCTTCGTAGTGTA
ATTTTCTTGCGGACAGTAAAGACTGGCGCCTTGTACACCAACACCCAATTGCGAGCCTAA
CACATCTGAGCTTGGAATTTGTCCCTCACTCATGCTCAGCCCATAGAACGCCTTCTCTCT
TTACTTCAACTTGCCACATCAATATCATTACCAAACTAATATGAAAGCTCATCTCGGTTT
CTTAATCGAGAGAATAAAAATTATCGTATGCCCACAGGGTAACCCATATTTATATCAAAT
GGAAGAAGCGTCCATTAAGAAAAAAGCAAAAAAAGCTGTACCTGCTATTATGGAGAGGAG
TAAGCGCTTTTCTCATTAACGTAAAAAGAGAGGTAAGAAAAAAAAGGAAGGGGACCTAGG
CACCTCATAGTGAGAAGATTGAAAACGGCGTATCAAACAA
Chromosomal Coordinates Chr II from 202056-203261
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator