Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name FLO1
Systematic Name YAR050W
Alias FLO2, FLO4
Description Lectin-like protein involved in flocculation, cell wall protein that binds to mannose chains on the surface of other cells, confers floc-forming ability that is chymotrypsin sensitive and heat resistant; similar to Flo5p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FLO1	6319341 upstream sequence, from -1000 to -1, size 1000
AAAAAAAAGTGCATTTATTTAGGTAAGTCTCATTACCTAAACGCCAGTTTGTTTCACGTA
ATTGGTAACGATGAGGGAACCGCAGTAGAAAAAACTTTCATTCACAAACGATTAAAGTGT
TATGCTAGCCAGTTTCAGGCTTTTTGTTTTATGCAAGAGAACATTCGACTAGATGTCCAG
TTAAGTGTGCGTCACTTTTCCTACGGTGCCTCGCACATGAATGTTATCCGGCGCACGATA
CTTATCACCGAAAAACCTTATTCTACGGAAAACCTTATTTACATTAAAGTTGGAAAAATT
TCCTCTTTTTCCTAATAAGGTGGAGCTTTTGGCTTCCAGTATGCTTTCACGGAATTATTT
CTCATGTACATTTAGCTCCATTTCCAGTGCCTCCGATAGGGAGGCATCATGGTACTACCG
TGACGGAGAATACGTAGGCTGACTTTTTCGTCAGTTTGTTGTCCGTTTACAAAATTGGTG
AATGAATTCTAGCCTTCCTCTGCTCATTAATTGCCCTCACAAGAATTTGGAAGTGCGTAG
ACAGGTAAAAGATTGTACTACAGAGGTATTGTGGAACCTTCTACAGTACTTCGGAATACA
CCTAAAAGGTTGTTGGATGCTAAATTTAGCAAAAGTCTTTTTTAGCTCACTATTAGGCTT
GTTAAAGTCTGAAATTGTTGAAAGGCACTCAAAAAGATAAATCAACAATCAGCATTAACG
GCACAGTTGAAAGAGTCACCCACTTGAAATTAGCTCGGTTATCAAATATAATTATCTCTG
GTAAAGAGCTCTGCAGCAGGGTTAATCTATTCGCATACTTACGCTGTAGGAACATTTTAT
TATTAGGATCCGACTACTGCCTACATATTTATTCGGAAGGCATGATGTCGAAAATTTTTG
AGCTTATAAAAGGAACATATTTCACTCTTGCTCGTTGATGTAAGCTCTCTTCCGGGTTCT
TATTTTTAATTCTTGTCACCAGTAAACAGAACATCCAAAA
Chromosomal Coordinates Chr I from 203403-208016
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator