Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ADE1
Systematic Name YAR015W
Description N-succinyl-5-aminoimidazole-4-carboxamide ribotide (SAICAR) synthetase, required for 'de novo' purine nucleotide biosynthesis; red pigment accumulates in mutant cells deprived of adenine
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ADE1	6319326 upstream sequence, from -1000 to -1, size 1000
TCCTCAAATTCAGAATCCGAATAATCATATGAGTCGGGCAATTCCGAAGAATTTTCTTTG
TAATGTCGCTGATCCCTTTTACTGTTGCTATGCATATGTTTTTCCACGTTCTCCTCCTCT
AACTCTTTGTCATCATCTCTATTTCGCAGAACATCATGGCCCTTTTCTGCCGCATTACTC
AGTATATTAAGTTTCGAATTGAAGGGCGAACTCTTATTCGAAGTCGGAGTCACCACAACA
CTTCCGCCCATACTCTCCGAATCCTCGTTTCCTAAAGTAAGTTTACTTCCACTTGTAGGC
CTATTATTAATGATATCTGAATAATCCTCTATTAGGGTTGGATCATTCAGTAGCGCGTGC
GATTGAAAGGAGTCCATGCCCGACGTCGACGTGATTAGCGAAGGCGCGTAACCATTGTCA
TGTCTAGCAGCTATAGAACTAACCTCCTTGACACCACTTGCGGAAGTCTCATCAACATGC
TCTTCCTTATTACTCATTCTCTTACCAAGCAGAGAATGTTATCTAAAAACTACGTGTATT
TCACCTCTTTCTCGACTTGAACACGTCCAACTCCTTAAGTACTACCACAGCCAGGAAAGA
ATGGATCCAGTTCTACACGATAGCAAAGCAGAAAACACAACCAGCGTACCCCTGTAGAAG
CTTCTTTGTTTACAGCACTTGATCCATGTAGCCATACTCGAAATTTCAACTCATCTGAAA
CTTTTCCTGAAGGTTGAAAAAGAATGCCATAAGGGTCACCCGAAGCTTATTCACGAGTCA
GTCTGACTCTTGCGAGAGATGAGGATGTAATAATACTAATCTCGAAGATGCCATCTAATA
CATATAGACATACATATATATATATATACATTCTATATATTCTTACCCAGATTCTTTGAG
GTAAGACGGTTGGGTTTTATCTTTTGCAGTTGGTACTATTAAGAACAATCGAATCATAAG
CATTGCTTACAAAGAATACACATACGAAATATTAACGATA
Chromosomal Coordinates Chr I from 169375-170295
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator