Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SEN34
Systematic Name YAR008W
Alias FUN4
Description Subunit of the tRNA splicing endonuclease, which is composed of Sen2p, Sen15p, Sen34p, and Sen54p; Sen34p contains the active site for tRNA 3' splice site cleavage and has similarity to Sen2p and to Archaeal tRNA splicing endonuclease
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SEN34	6319322 upstream sequence, from -1000 to -1, size 1000
CATCACCTCTTTGATTGTGCCACGTTTTAATTTCTCCCTTGTAGGAAACTCTTGCTTTGA
TAGTCCAAACGTTTTGGTATGGAGACAGTTGTTCGATGGCAAAAATTGGTCTGGTTTTTT
GCGAATTAGGGTTTTCATTGGCGAATTTTCTCTCATTTGCATTCAAGTTTGAGTTTGAAT
GCAGCATATCAGGGACACCAGCATTGCTGGCGTTTGTTTGATTGGCAACATTACCACTGT
CAGTTATATCTTCGTCTTTTAAGGTTTCATTTGGATGCTCTGAGAAATAGTTATCCAAAA
AAGTACTAGTTTGGTTGACCATATCAGCACGCGACTGGACCAACTCAAAGTCATCTACTA
AAAGAACGTATTTCTTTCTTTCCCTGACAATAGCAGGTTCTGCAATTATCACGCGAATGA
TATCACCCCTTTGTAGTTCCATTGACTGGAACTTGGATGCAGCTTGGTTTCTCAACAGAG
CCTTCATATGGTAAATACCATCGGAAATCATGATCAAATTCTTTCTGTTGCTGTTAGCCC
CATCAGATTTCCTGGTGTTATAAACTTGATAAACGCCACCGGTGGGATTATCGTACCTTT
GCTTATTGGTGAAGATGCTATGAAAATCGCCCCTCGAAAGTTGAACACTGCTCATCTCTT
GTAAGTATAATCTGGTCTTCTTGCTGGTTTCGCCTTTACCGTAATAAGAAGAGTGAATAG
TTTTTGTTTTACGTGTAGAACTTAAAGTGATAACATTTGTTCAAGTAAACCTTTATGTTA
GTTCACGCGTCTTTTGTCGCCTCGTCTAATTTTTACGCGTGACATTTTTCCAAGCAGAGA
TATTTTATTGAGCAGCGAAGAAGAGTTAGAGAATAAGAAAGTGATGCGATAAGAAATCCA
CCCAATTAGCATAGATCCTTTCGTATATGGCTGAAGAAGGTGGTACGCGCATAGCTATTA
ACATATATCAAAAAGAACGGCAAAAGGCGAGGAGGTTTTT
Chromosomal Coordinates Chr I from 158966-159793
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator