Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name BDH2
Systematic Name YAL061W
Description Putative medium-chain alcohol dehydrogenase with similarity to BDH1; transcription induced by constitutively active PDR1 and PDR3
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YAL061W	6319257 upstream sequence, from -1000 to -1, size 1000
GTACGTTGCAGGAGCACGCCCATGGACGCATGTGAGCAACGTCGACATTGCCTTGCCCTG
TGCCACCCAAAACGAGGTCAGTGGTGACGAAGCCAAGGCCCTAGTGGCATCTGGCGTTAA
GTTCGTTGCCGAAGGTGCTAACATGGGTTCTACACCCGAGGCTATTTCTGTTTTCGAAAC
AGCGCGTAGCACTGCAACCAATGCAAAGGATGCAGTTTGGTTTGGGCCACCAAAGGCAGC
TAACCTGGGCGGCGTGGCAGTATCCGGTCTGGAAATGGCTCAGAATTCTCAAAAAGTAAC
TTGGACTGCCGAGCGGGTCGATCAAGAACTAAAGAAGATAATGATCAACTGCTTCAACGA
CTGCATACAGGCCGCACAAGAGTACTCTACGGAAAAAAATACAAACACCTTGCCATCATT
GGTCAAGGGGGCCAACATTGCCAGCTTCGTCATGGTGGCTGACGCAATGCTTGACCAGGG
AGACGTTTTTTAGCCGTAAGCGCTATTTTCTTTTTGTTCGTAACTATCTGTGTATGTAGT
AGTGTAATCTACTTTTAATTTACTATGCAAATAGGGTTCAGCATTACGGAAGAAACTGAA
ATCCCTTCCGCGGAAGTTTCTTAGTAGTGGCCGTGCGGGGTGAGGAGATTACATGTCGGT
AATTAGATGATTAACCTAGGCAATTTGAAGGGGGATAGTGGCATTGGTTAGCTCAGATAT
GATAAGGAGAACTAAGCAAGGGGGTTAACCACCACGGCTGTAGCACAAGACCGGCAGATG
CGATTATTAGCAACACATTAGTTAATGCTTTTGATAAAATGTATATAAAGGCTGTCGTAA
TGTGCAGTAGTAAGGACCTGACTGTGTTTGTGGTTCTCTTCATTCTTGAACCTTGTCATT
GGTAAAAGACCATCGTCAAGATATTTGAAAGTTAATAGACAGTTAACAATAATAACAACA
GCAATAAGAATAACAATAAATTCATTGAACATATTTCAGA
Chromosomal Coordinates Chr I from 33448-34701
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator