Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name BDH1
Systematic Name YAL060W
Alias BDH
Description NAD-dependent (R,R)-butanediol dehydrogenase, catalyzes oxidation of (R,R)-2,3-butanediol to (3R)-acetoin, oxidation of meso-butanediol to (3S)-acetoin, and reduction of acetoin; enhances use of 2,3-butanediol as an aerobic carbon source
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BDH1	6319258 upstream sequence, from -1000 to -1, size 1000
GGTTTACGACCCAACTGCGCACGCTGCCAAGGAGAGCATTGATTATCTGAGGTCGATTGC
TGATGGTGGAGACGGCTTCGATTACACATTTGATTGCTCCGGGTTGGAAGTCACATTGAA
TGCTGCTATTCAGTGTCTCACTTTCAGAGGCACCGCAGTGAACTTGGCCATGTGGGGCCA
TCACAAGATACAGTTTTCTCCGATGGACATCACATTGCATGAAAGAAAGTACACAGGGTC
CATGTGCTACACACACCACGATTTTGAGGCAGTAATAGAAGCTTTGGAAGAAGGCAGGAT
TGACATTGATAGAGCAAGACATATGATAACGGGCAGAGTCAACATTGAGGACGGCCTTGA
TGGCGCCATCATGAAGCTGATAAACGAGAAGGAGTCTACAATCAAGATTATTCTGACTCC
AAACAATCACGGAGAGTTGAACAGGGAAGCCGATAATGAGAAGAAAGAAATTTCCGAGCT
GAGCAGTCGGAAAGATCAAGAAAGACTACGAGAATCAATAAACGAGGCTAAACTGCGTCA
CACATGATTGTGATTGAGTACTCACGTTCTCGTGTTAATCCCGCGGTCTTCTTGTTTTAC
TAACTTTTCTTTCTCTCATAGCATTCTCTTGACAGTGTTTTATATACATCATATGTACAT
TTATCGAGCCAATCGAGGGCAGCAGTTTAACATCAAGCCGGATTTGCTCACGCTACTTTG
ACCCCTTTTCGTTTCGACGGAGAGAAGAAACCGGTGTTTTCCTATCCTTGCCTATTCTTT
CCTCCTTACGGGGTCCTAGCCTGTTTCTCTTGATATGATAATAGGTGGAAACGTAGAAAA
AAAAATCGACATATAAAAGTGGGGCAGATACTTCGTGTGACAATGGCCAATTCAAGCCCT
TTGGGCAGATGTTGCCCTTCTTCTTTCTTAAAAAGTCTTAGTACGATTGACCAAGTCAGA
AAAAAAAAAAAAAAGGAACTAAAAAAAGTTTTAATTAATT
Chromosomal Coordinates Chr I from 35155-36303
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator