Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name MYO4
Systematic Name YAL029C
Alias FUN22, myosin 4, SHE1
Description One of two type V myosin motors (along with MYO2) involved in actin-based transport of cargos; required for mRNA transport, including ASH1 mRNA, and facilitating the growth and movement of ER tubules into the growing bud along with She3p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MYO4	6319290 upstream sequence, from -1000 to -1, size 1000
GAAGACTTCATCGTACTGAGACTTCGTACTTTATCTGGTGCTGCGTTGAACATACAATCG
CTGAACATTGCGGTCGAGGCAGACGTGTAATCCGGAATAACTTGACGATGCAGTTTATGA
CGAGCATGATGGTGCTCCATTTCATATTTCTGCTCTTTTTCGTGTAATGCAGCCAAATTA
CTGTGAGAGGCTTGCCATCCAACGTTTGGCTTAGTTTCAACAGTAGATTTGTGGCCAACA
TCTGGTGTTCCAGCGTCAATCATTTGCTTTACATCTTCCAGGGGTCTCTTTTCTACACCA
TCTTTGCTATTGCGATCTGTACCATCTATTCCGCTGCCTTTAGAAGAGCTCTTTATTTGA
GCATTTTGCATTGTACCTGGACAACTACTGGACTACGTAAAAAACTGCCATCAATTTGTG
TTATTCTTACTCTTTGAGACAATGTTTCATAACAATAGAACAATAGCTTTTTGACCTTCC
CCTTATTTTATTTCAAAAGGTAACAGTTAGGGCTATTCTTAAACTTTCTTTAGGGTACAC
AATGAAAACATCAAGATTGAGTTAAAACCCTTAAAATAAAACTAGGTCTTTAAGAAACTC
ACTCTCCGGGTTATCCATAGAATGTTTACCATTCTTTAGGGTTCTGAACTAATGCGAAAA
AAAAAAAAGAAAAGACTGAAAAATTCGAAAATATCTCGAAGTTTAGCAGTAGTAGATGAG
AATAGGGTCTCTTTTATCGAAAACCTGCAATTGTAATACAACCTTTTTTTGAAAGTCAGC
CTTTATTCTGATTCTGCATACTCAATTCCTCAATTCCTACGGAGTTATCACCTTTTTTTT
TACCTTCTCTTCTTTTCTTATTGTTCTAGCTGAAAACATTGTTACCAGTTTGGCGAGACA
ATTTATTTTCAATACGATACCCTTTTGTTCTTCTTTTTATAATTCAATCTAATTCTAAAA
CACAAAAAAACAAAAAAAATCCTATAACCAGTTCTCCCGC
Chromosomal Coordinates Chr I from 92270-87855
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator