Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name VPS8
Systematic Name YAL002W
Alias FUN15, VPL8, VPT8
Description Membrane-associated protein that interacts with Vps21p to facilitate soluble vacuolar protein localization; component of the CORVET complex; required for localization and trafficking of the CPY sorting receptor; contains RING finger motif
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VPS8	6319316 upstream sequence, from -1000 to -1, size 1000
GTGCTCACCAATTTATCCCAATTGGTTTCGGTATCAAGAAGTTGCAAATTAACTGTGTTG
TCGAAGATGACAAGGTTTCCTTGGATGACTTGCAACAAAGCATTGAAGAAGACGAAGACC
ACGTCCAATCTACCGATATTGCTGCTATGCAAAAATTATAAAAGGCTTTTTTATAAACTT
TTTATAATTAACATTAAAGCAAAAACAACATTGTAAAGATTAACAAATAAATGAAAAAAA
CAACGAAATAACTTAGGTTTTAGGCTAAAAAAAACAGAAGGAATTTTGAACGATAAACTT
TTCGACTGCACACGAAACATTATTACTAATTTGTGTAACCACTATATAAGGAATCGTGTT
TATTAATTGAATTTATTCCGGGAATATTCAAGTTATGTATATCTCTTTTCATATTCTTAA
ATACACATACTCATAATATCTTGTCGAAAATACGCGGTGTAGGGAGTTATGGTGGATAAC
TTTTTCACGATTAGAAGAAAAGGAAAATTTCATTATTCGTAGCTTAACATGGCAAAAACG
AGAAAGACATATAATCAAAACGTGAGTTTCCTGTGGAAAAAAAAAAAAGGGAACCTCTGG
TTACGATGATATACCTGCGTGAAAAAGGACAGTTATTACCAATACATACAAAGGCTTAAT
AAGTGTAAAATATATATCTGCCGAGACCATTACTCATTACACCTAGAATGGAGCAAAATG
GCCTTGACCACGACAGCAGATCTAGCATCGATACGACTATTAATGACACTCAAAAGACTT
TCCTAGAATTTAGATCGTATACCCAATTAAGTGAAAAACTGGCATCTAGTTCTTCATATA
CGGCACTCCCCTGAACGAAGATGGTCCTAAAGGGGTAGCTTCTGCAGTGTCACAAGGCTC
CGAATCCGTAGTCTCATGGACAACTTTAACACACGTATATTCCATCCTGGGTGCTTATGG
AGGGCCCACGTGCTTGTATCCGACAGCCACGTATTTTTTG
Chromosomal Coordinates Chr I from 143707-147531
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator