Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name TFC3
Systematic Name YAL001C
Alias FUN24, TSV115
Description Largest of six subunits of the RNA polymerase III transcription initiation factor complex (TFIIIC); part of the TauB domain of TFIIIC that binds DNA at the BoxB promoter sites of tRNA and similar genes; cooperates with Tfc6p in DNA binding
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TFC3	6319317 upstream sequence, from -1000 to -1, size 1000
ACTTGTAAATATATCTTTTATTTTCCGAGAGGAAAAAGTTTCAAAAAAAAAAAAAAAAAA
AGAAGAAAAATAACTTTCTCATGTAATAAAAGGTAACTAATGTAGACAAAAAAGTATACA
TTTAGCTTTTCTTTTTTTGATGATTTTTGAGTTTCATGTTACTAATCAGAACAATTAACG
ACACCTTCATTATGAAAAAATTAATTAGCTATAAGTCTTCGAAGTAGAACATGATATTTG
GCAATCACTCGAATAACTATCTTAATTTACCTGCTGAAATAATTTGAAAAAACACCCGAG
GCAGCAGACGAAAGGTGTTTTTGCTAAACAATGATTGATTTCTGGCGCCATTTCTACATT
CTGAACAGTTCATCTCATTTCAGTAACAGTACTTCAATGGAATATTTATTAAAGAAAGTG
CTTAAAAAAGTATTATAAAACGATACATGGACTGACTCAAGATTGAGCTAATAAGGTCCA
CCGCCTAGTGCTTAAGAGTTCTGTACCACTATAATAATTTATCTTGATCGTATTATGTGT
AAAAAAAAGGCGCTTGAAATGAAAGCTCCGAAAATTAAAATACTTTGACTGCTTCGGAAA
ACAAAAACATATAAATAAATTTAAAAAATAAACTGTAAAATATTTAAAAACTATTAAAAA
TATTTTATATTTTTAAAATTATTTATTATTATGTCATGTGACAAGACTTAAATCATTACA
TAAAAGGTTTTGAAGTTCAATGTCAAAGTCAATATAATAAGCATACTAAGGCACACTTAT
GCAAATCGAGTTATTGAAGCTGGTAAAATTATAAGATTTTTATTTTTATTTCTTTTATTT
CTGCAAATCTGCATTTTCAAATACCGCTTGGTTTTTTGCATCATAAAGGGCGGCGCTTTC
AGTCGCGAAAGTGAAATAAACAACCAGTCACACATATAACTTTCTTCTTGCCATAAGAGA
GAAGAGGACGTTTGGTTGAAGCCAACTAGCCACAAGAAAA
Chromosomal Coordinates Chr I from 151006-147594,151166-151097
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator