Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name OLI1
Systematic Name Q0130
Alias ATP9, OLI3
Description F0-ATP synthase subunit c (ATPase-associated proteolipid), encoded on the mitochondrial genome; mutation confers oligomycin resistance; expression is specifically dependent on the nuclear genes AEP1 and AEP2
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>OLI1	6226533 upstream sequence, from -1000 to -1, size 1000
AATAAAATAAACTTAATTAAATATTATATATTTATTTACAATTATATATATATATTACTC
ATAATTAAATTAAATTAAGATGCAATTCAATACGGTTGTATTATATTATTCATCAAATAT
TGTTAATATTGATACCTACAGAGATATTTAATATTTTTATTATTATTATCCATTACTTTT
TTTATTATATTTTAATTATTTATTTATTTATTTATTTATAATAATAATATTTCATATTAT
CAATTATTATTTTTTTTTTTTATAATATATAATTAAATTATTTATATAGTTCCCCGAAAG
GAGAATAAATAAAATATTATATAAATATTTATATCTTTATTAATATTAATATAAGTAATA
TATATAGTTTATGATATTTAATTTTATCATAATATAATAATAATTATATAAATCTTATAC
ACATTTATATAAGTATATATATATATTATTAATATAATGAACATCTATTAAATAAAATAA
TTGTAAATCTCAAGTAAATTATTATTATTTTATTTTTAATAATAATTTATGATTTATAAT
TAATAAATAAAAGAGTAATTATATGATAAAAAAGGTAATAAATAAAATTTATAGTTCCGG
GGCCCGGCCACGGGAGCCGGAACCCCGAAAGGAGTTTATTTATATATATATATATATGAA
TTAATATTTAATAATAAATAATAATATAATTAATAATATTATTATTATTATAATTTTTTT
ATTTATAATATTAATAAAATATTATTATATATATATTATAATAATATTAATAAGATATAT
AAATAAGTCCCTTTTTTTTTATTTAAAATAAAGAAAGAATAATTAAATAATATTTTAATA
ATTTAATTAAATAGTGTATTAAAAGATAATAAAAAGTAATATTAATATGTTAATTATATA
TAATATATTTATATATAATTATATATATATATATAAATAATAATAAATATATATATAATA
TAAAAATAAGAATAGATTAAATATTTAATAAATAAATATT
Chromosomal Coordinates Chr Mito from 46723-46953
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator